Neurochemistry and subjunctivities of depression in Kerala, South India.

The narrative of depression as a neurochemical imbalance in the brain or, more precisely, a deficiency of the neurotransmitters serotonin and norepinephrine – largely produced by commercial interests of the international and national pharmaceutical industry and spread globally by international diagnostic systems – has found its way into the offices of mainstream psychiatrists in Kerala. In the clinical encounters, social, economic and existential suffering is thus transformed into a medical condition, treatable with pharmacological means.

On the one hand, the setting of a psychiatric outpatient department largely shapes the way depressive patients express their subjectivities. On the other hand, the diagnosis (and explanation) of depression as neurochemical imbalance and the prescription of drugs influences the way patients experience their suffering. Using two ethnographic examples, the aim of this paper is to analyze how subjectivities are construed and shaped in the process of negotiating depression in clinical encounters in mainstream psychiatric institutions in Kerala and how multiple framings and ontologies of affliction are assembled in them.

Subjectivities of depression are, it will be argued, less coherent than ambigious and fractured, unstable and fragile. They engage, accentuate and sometimes merge different, often contradictory discourses.

9998 SCREW CAP 415/13

9998-13 288/pk
EUR 198
Description: General Apparatus; Stoppers


99447-13 250/pk
EUR 332
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock


99449-13 250/pk
EUR 281
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

Bovine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-b-48T 48T
EUR 547
  • Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-b-96T 96T
EUR 715
  • Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ch-48T 48T
EUR 508
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ch-96T 96T
EUR 661
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-48T 48T
EUR 385
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-96T 96T
EUR 492
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Mu-48T 48T
EUR 489
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Mu-96T 96T
EUR 635
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-p-48T 48T
EUR 547
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-p-96T 96T
EUR 715
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ra-48T 48T
EUR 426
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ra-96T 96T
EUR 549
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Rb-48T 48T
EUR 508
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Rb-96T 96T
EUR 661
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-b-48Tests 48 Tests
EUR 580

Bovine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-b-96Tests 96 Tests
EUR 807

Chicken C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ch-48Tests 48 Tests
EUR 534

Chicken C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ch-96Tests 96 Tests
EUR 742

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-48Tests 48 Tests
EUR 388

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-96Tests 96 Tests
EUR 533

Mouse C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Mu-48Tests 48 Tests
EUR 511

Mouse C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Mu-96Tests 96 Tests
EUR 709

Porcine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-p-48Tests 48 Tests
EUR 580

Porcine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-p-96Tests 96 Tests
EUR 807

Rat C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ra-48Tests 48 Tests
EUR 437

Rat C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ra-96Tests 96 Tests
EUR 603

Rabbit C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Rb-48Tests 48 Tests
EUR 534

Rabbit C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Rb-96Tests 96 Tests
EUR 742

Bovine C Reactive Protein (CRP) ELISA Kit

RD-CRP-b-48Tests 48 Tests
EUR 555

Bovine C Reactive Protein (CRP) ELISA Kit

RD-CRP-b-96Tests 96 Tests
EUR 771

Chicken C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ch-48Tests 48 Tests
EUR 511

Chicken C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ch-96Tests 96 Tests
EUR 709

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-48Tests 48 Tests
EUR 372

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-96Tests 96 Tests
EUR 510

Mouse C Reactive Protein (CRP) ELISA Kit

RD-CRP-Mu-48Tests 48 Tests
EUR 489

Mouse C Reactive Protein (CRP) ELISA Kit

RD-CRP-Mu-96Tests 96 Tests
EUR 677

Porcine C Reactive Protein (CRP) ELISA Kit

RD-CRP-p-48Tests 48 Tests
EUR 555

Porcine C Reactive Protein (CRP) ELISA Kit

RD-CRP-p-96Tests 96 Tests
EUR 771

Rat C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ra-48Tests 48 Tests
EUR 419

Rat C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ra-96Tests 96 Tests
EUR 577

Rabbit C Reactive Protein (CRP) ELISA Kit

RD-CRP-Rb-48Tests 48 Tests
EUR 511

Rabbit C Reactive Protein (CRP) ELISA Kit

RD-CRP-Rb-96Tests 96 Tests
EUR 709

Guinea pig C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Gu-48T 48T
EUR 527
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Gu-96T 96T
EUR 688
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Gu-48Tests 48 Tests
EUR 557

Guinea pig C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Gu-96Tests 96 Tests
EUR 774

Guinea pig C Reactive Protein (CRP) ELISA Kit

RD-CRP-Gu-48Tests 48 Tests
EUR 533

Guinea pig C Reactive Protein (CRP) ELISA Kit

RD-CRP-Gu-96Tests 96 Tests
EUR 740

TruStrip RDT Dog C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-D10 1 pack
EUR 171

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-H10 1 pack
EUR 171

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack

CRP-RDT-H25 1 pack
EUR 293

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-M10 1 pack
EUR 171

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack

CRP-RDT-M25 1 pack
EUR 293

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-R10 1 pack
EUR 171

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack

CRP-RDT-R25 1 pack
EUR 293

CA199 (Cancer antigen) ELISA test

13 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)


ELA-E0829r 96 Tests
EUR 886

Crp/ Rat Crp ELISA Kit

ELI-02799r 96 Tests
EUR 886


QY-E70170 96T
EUR 426


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRP Antibody

BF0116 200ul
EUR 376
Description: CRP antibody detects endogenous levels of total CRP.

CRP Antigen

E64C00501 1mg
EUR 700

CRP Antigen

E64C00502 1mg
EUR 700

CRP Protein

abx069766-50ml 50 ml
EUR 1205
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRP Antiboday

70R-51961 100 ug
EUR 197
Description: Purified Rabbit CRP antibody

CRP protein

80R-4350 50 ug
EUR 349
Description: Purified Recombinant CRP protein (His tagged)

CRP antibody

70R-4527 50 ug
EUR 467
Description: Rabbit polyclonal CRP antibody raised against the N terminal of CRP

CRP Antibody

ABD6027 100 ug
EUR 438

CRP antibody

10C-CR2015M1 1 mg
EUR 168
Description: Mouse monoclonal CRP antibody

CRP antibody

10C-CR2015M5 1 mg
EUR 165
Description: Mouse monoclonal CRP antibody

CRP antibody

10C-CR2015M6 1 mg
EUR 165
Description: Mouse monoclonal CRP antibody

CRP antibody

10R-10264 50 ug
EUR 241
Description: Mouse monoclonal CRP antibody

CRP antibody

10R-1042 100 ul
EUR 349
Description: Mouse monoclonal CRP antibody

CRP antibody

10-2276 100 ug
EUR 221
Description: Recombinant Fab monoclonal CRP antibody

CRP antibody

10-2349 1 mg
EUR 349
Description: Mouse monoclonal CRP antibody

CRP antibody

10-2350 1 mg
EUR 349
Description: Mouse monoclonal CRP antibody

CRP antibody

10-2703 1 mg
EUR 165
Description: Mouse Monoclonal CRP antibody

CRP antibody

10-7893 1 mg
EUR 392
Description: Mouse monoclonal CRP antibody

CRP antibody

10-7894 1 mg
EUR 403
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C189A 1 mg
EUR 245
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C189B 1 mg
EUR 420
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C33A 1 mg
EUR 238
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C33AS 1 mg
EUR 235
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C33B 1 mg
EUR 662
Description: Mouse monoclonal CRP antibody

CRP antibody

10-C33C 1 mg
EUR 245
Description: Mouse monoclonal CRP antibody

CRP antibody

10R-8426 100 ul
EUR 393
Description: Mouse monoclonal CRP antibody

CRP antibody

10-1004 1 mg
EUR 457
Description: Mouse monoclonal CRP antibody

CRP antibody

10R-C189a 1 mg
EUR 284
Description: Mouse monoclonal CRP antibody

CRP antibody

10R-C189b 1 mg
EUR 399
Description: Mouse monoclonal CRP antibody

CRP protein

30C-CP1000U 1 mg
EUR 349
Description: Purified native Human CRP protein

CRP protein

30R-2081 100 ug
EUR 322
Description: Recombinant human CRP protein

CRP protein

30R-2389 250 ug
EUR 152
Description: Purified recombinant Human CRP protein

CRP protein

30R-2740 10 ug
EUR 341
Description: Purified recombinant Human CRP protein

CRP protein

30R-2984 1 mg
EUR 380
Description: Purified recombinant Human CRP protein

CRP Protein

30R-3412 1 mg
EUR 300
Description: Human C-reactive protein

CRP protein

30R-AC001x 10 mg
EUR 457
Description: Highly purifed Human CRP protein

CRP protein

30R-AC067 1 mg
EUR 448
Description: Purified native Human CRP protein

CRP Antibody

31062-100ul 100ul
EUR 252

CRP Antibody

31062-50ul 50ul
EUR 187

CRP protein

30-1092 1 mg
EUR 393
Description: Purified recombinant Human CRP protein

CRP protein

30-1094 100 ug
EUR 155
Description: Purified native Human CRP protein

CRP protein

30-1906 1 mg
EUR 336
Description: Native human CRP protein

CRP protein

30-AC05 5 mg
EUR 277
Description: Highly purified Human CRP protein

CRP protein

30-AC07 5 mg
EUR 1029
Description: Purified Recombinant CRP protein

CRP protein

30-AC10 5 mg
EUR 250
Description: Partially purified Human CRP protein

CRP Antibody

32023-100ul 100ul
EUR 252

CRP antibody

10R-3002 100 ug
EUR 265
Description: Mouse monoclonal CRP antibody

CRP antibody

20C-CR2015S 1 ml
EUR 133
Description: Sheep polyclonal CRP antibody

CRP antibody

20C-CR2015SP 1 ml
EUR 177
Description: Sheep polyclonal CRP antibody

CRP antibody

20-1002 1 ml
EUR 111
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-1003 1 ml
EUR 133
Description: Rabbit polyclonal Human CRP antibody

CRP antibody

20-1262 1 ml
EUR 647
Description: Sheep polyclonal CRP antibody

CRP antibody

20-B9007G000-W0 10 ml
EUR 116
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-B9007GD00-D0 5 mg
EUR 138
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S3903GND1-D0 1 ml
EUR 133
Description: Polyclonal CRP antibody

CRP antibody

20-S3903GND9-D0 10 ml
EUR 127
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S3911G000-S4 10 ml
EUR 116
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S3911G000-V0 10 ml
EUR 133
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S3911G001-V0 10 ml
EUR 133
Description: Goat polyclonal Human CRP antibody

CRP antibody

20-S6011G000-S4 10 ml
EUR 138
Description: Goat polyclonal CRP antibody

CRP Antibody

EUR 338

CRP Antibody

EUR 146

CRP antibody

70R-13710 100 ug
EUR 322
Description: Affinity purified Sheep polyclonal CRP antibody

CRP antibody

70-B9007GA00-A0 5 mg
EUR 241
Description: Goat polyclonal Human CRP antibody

CRP antibody

70R-10663 1 ml
EUR 484
Description: Rabbit polyclonal CRP antibody

CRP Antibody

DF6027 200ul
EUR 304
Description: CRP Antibody detects endogenous levels of total CRP.

CRP Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CRP. Recognizes CRP from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CRP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

crp Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against crp. Recognizes crp from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA

CRP Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

CRP Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200


YF-PA27200 50 ug
EUR 363
Description: Mouse polyclonal to CRP

hs-CRP/ Rat hs- CRP ELISA Kit

ELA-E0821r 96 Tests
EUR 886

Polyclonal CRP Antibody

APG02787G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRP . This antibody is tested and proven to work in the following applications:

Large-CRP OmcBProtein

  • EUR 843.00
  • EUR 439.00
  • EUR 1274.00
  • EUR 1636.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1 month.

Large-CRP OmcBProtein

  • EUR 2764.00
  • EUR 1734.00
  • 100 ug
  • 50 ug
  • Shipped within 3 months.

CRP Blocking Peptide

BF0116-BP 1mg
EUR 195

CRP Conjugated Antibody

C31062 100ul
EUR 397

CRP Conjugated Antibody

C32023 100ul
EUR 397

CRP cloning plasmid

CSB-CL005991HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 276
  • Sequence: atggagaagctgttgtgtttcttggtcttgaccagcctctctcatgcttttggccagacagacatgtcgaggaaggcttttgtgtttcccaaagagtcggatacttcctatgtatccctcaaagcaccgttaacgaagcctctcaaagccttcactgtgtgcctccacttctacac
  • Show more
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid

CSB-CL005991HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 141
  • Sequence: atgtgggactttgtgctgtcaccagatgagattaacaccatctatcttggcgggcccttcagtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid

CSB-CL005991HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Show more
Description: A cloning plasmid for the CRP gene.

anti- CRP antibody

FNab01994 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IF: 1:50 - 1:200
  • Immunogen: C-reactive protein, pentraxin-related
  • Uniprot ID: P02741
  • Gene ID: 1401
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against CRP

anti- CRP antibody

FNab01995 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:4000
  • IHC: 1:50-1:500
  • Immunogen: C-reactive protein, pentraxin-related
  • Uniprot ID: P02741
  • Gene ID: 1401
  • Research Area: Immunology, Cardiovascular
Description: Antibody raised against CRP

CRP Polyclonal Antibody

ES3926-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CRP from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CRP Polyclonal Antibody

ES3926-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CRP from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CRP Polyclonal Antibody

ABP52927-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CRP
  • Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

CRP Polyclonal Antibody

ABP52927-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CRP
  • Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

CRP Polyclonal Antibody

ABP52927-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CRP
  • Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

Human CRP Protein

abx060113-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Human CRP Protein

abx060138-1mg 1 mg
EUR 453
  • Shipped within 5-10 working days.

Human CRP Protein

abx060712-1mg 1 mg
EUR 704
  • Shipped within 5-10 working days.

Human CRP Antibody

abx023919-10ml 10 ml
EUR 356
  • Shipped within 5-10 working days.

CRP Rabbit pAb

A0224-100ul 100 ul
EUR 308

CRP Rabbit pAb

A0224-200ul 200 ul
EUR 459

CRP Rabbit pAb

A0224-20ul 20 ul
EUR 183

CRP Rabbit pAb

A0224-50ul 50 ul
EUR 223

CRP Polyclonal Antibody

A52500 100 µg
EUR 570.55
Description: reagents widely cited

crp Polyclonal Antibody

A55435 100 µg
EUR 570.55
Description: Ask the seller for details

CRP Rabbit pAb

A15659-100ul 100 ul
EUR 308

CRP Rabbit pAb

A15659-200ul 200 ul
EUR 459

CRP Rabbit pAb

A15659-20ul 20 ul
EUR 183

CRP Rabbit pAb

A15659-50ul 50 ul
EUR 223

CRP Blocking Peptide

33R-5929 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRP antibody, catalog no. 70R-4527

CRP calibrator set

35-S6021H000-L4 5 ml
EUR 133
Description: C-reactive Protein Calibrator Set

CRP Polyclonal Antibody

41605-100ul 100ul
EUR 252

CRP Polyclonal Antibody

41605-50ul 50ul
EUR 187

CRP, human recombinant

EUR 256

CRP, human recombinant

EUR 5270

CRP, human recombinant

EUR 588

CRP, human recombinant

EUR 332

CRP, human recombinant

EUR 147


1030 1 kit
EUR 629


1031 1 kit
EUR 629


1032 1 kit
EUR 629

CRP monoclonal antibody

10R-11480 1 mg
EUR 354
Description: Mouse anti-human C-reactive protein monoclonal antibody

Anti-CRP Purified

11-480-C100 0.1 mg
EUR 204

Anti-CRP Purified

11-484-C100 0.1 mg
EUR 204

Anti-CRP Purified

11-537-C100 0.1 mg
EUR 204

Anti-CRP Biotin

1B-484-C100 0.1 mg
EUR 286

CRP protein (Canine)

30-1093 100 ug
EUR 702
Description: Purified native Canine CRP protein

CRP antibody (FITC)

60R-2348 100 ug
EUR 327
Description: Rabbit polyclonal CRP antibody (FITC)

CRP Antibody, HRP

60R-2349 100 ug
EUR 332
Description: Rabbit polyclonal CRP antibody (HRP)


55R-IB59126 96 wells
EUR 378
Description: ELISA kit for the detection of CRP in the research laboratory


55R-IB79102 96 wells
EUR 579
Description: ELISA kit for the detection of CRP in the research laboratory

They should therefore better be referred to as ‘subjunctivities’. The idiom of depression often becomes a rhetorical device to emphasize affiliation to a scientific medical discourse or citizenship and is often a statement to emphasize ‘scientific temper’ and modernity and to demarcate oneself from backwardness and superstition.