Neurochemistry and subjunctivities of depression in Kerala, South India.

The narrative of depression as a neurochemical imbalance in the brain or, more precisely, a deficiency of the neurotransmitters serotonin and norepinephrine – largely produced by commercial interests of the international and national pharmaceutical industry and spread globally by international diagnostic systems – has found its way into the offices of mainstream psychiatrists in Kerala. In the clinical encounters, social, economic and existential suffering is thus transformed into a medical condition, treatable with pharmacological means.

On the one hand, the setting of a psychiatric outpatient department largely shapes the way depressive patients express their subjectivities. On the other hand, the diagnosis (and explanation) of depression as neurochemical imbalance and the prescription of drugs influences the way patients experience their suffering. Using two ethnographic examples, the aim of this paper is to analyze how subjectivities are construed and shaped in the process of negotiating depression in clinical encounters in mainstream psychiatric institutions in Kerala and how multiple framings and ontologies of affliction are assembled in them.

Subjectivities of depression are, it will be argued, less coherent than ambigious and fractured, unstable and fragile. They engage, accentuate and sometimes merge different, often contradictory discourses.

9998 SCREW CAP 415/13
9998-13 288/pk
EUR 198.00
Description: General Apparatus; Stoppers

99447 DSSCT 13 X 100MM W/ MARING SPOT
99447-13 250/pk
EUR 332.00
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

99449 DSSCT 13 X 100MM W/O MARKING SPOT
99449-13 250/pk
EUR 281.00
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

Bovine C Reactive Protein (CRP) ELISA Kit
DL-CRP-b-192 1 kit of 192 tests
EUR 1231.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine C Reactive Protein (CRP)

Bovine C Reactive Protein (CRP) ELISA Kit
DL-CRP-b-48 1 kit of 48 tests
EUR 510.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine C Reactive Protein (CRP)

Bovine C Reactive Protein (CRP) ELISA Kit
DL-CRP-b-96 1 kit of 96 tests
EUR 685.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Bovine C Reactive Protein (CRP)

Chicken C Reactive Protein (CRP) ELISA Kit
DL-CRP-Ch-192 1 kit of 192 tests
EUR 1130.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Chicken C Reactive Protein (CRP)

Chicken C Reactive Protein (CRP) ELISA Kit
DL-CRP-Ch-48 1 kit of 48 tests
EUR 474.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Chicken C Reactive Protein (CRP)

Chicken C Reactive Protein (CRP) ELISA Kit
DL-CRP-Ch-96 1 kit of 96 tests
EUR 635.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Chicken C Reactive Protein (CRP)

Human C Reactive Protein (CRP) ELISA Kit
DL-CRP-Hu-192 1 kit of 192 tests
EUR 807.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human C Reactive Protein (CRP)

Human C Reactive Protein (CRP) ELISA Kit
DL-CRP-Hu-48 1 kit of 48 tests
EUR 361.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human C Reactive Protein (CRP)

Human C Reactive Protein (CRP) ELISA Kit
DL-CRP-Hu-96 1 kit of 96 tests
EUR 473.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Human C Reactive Protein (CRP)

Mouse C Reactive Protein (CRP) ELISA Kit
DL-CRP-Mu-192 1 kit of 192 tests
EUR 1079.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse C Reactive Protein (CRP)

Mouse C Reactive Protein (CRP) ELISA Kit
DL-CRP-Mu-48 1 kit of 48 tests
EUR 456.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse C Reactive Protein (CRP)

Mouse C Reactive Protein (CRP) ELISA Kit
DL-CRP-Mu-96 1 kit of 96 tests
EUR 609.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Mouse C Reactive Protein (CRP)

Porcine C Reactive Protein (CRP) ELISA Kit
DL-CRP-p-192 1 kit of 192 tests
EUR 1231.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Porcine C Reactive Protein (CRP)

Porcine C Reactive Protein (CRP) ELISA Kit
DL-CRP-p-48 1 kit of 48 tests
EUR 510.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Porcine C Reactive Protein (CRP)

Porcine C Reactive Protein (CRP) ELISA Kit
DL-CRP-p-96 1 kit of 96 tests
EUR 685.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Porcine C Reactive Protein (CRP)

Rat C Reactive Protein (CRP) ELISA Kit
DL-CRP-Ra-192 1 kit of 192 tests
EUR 916.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat C Reactive Protein (CRP)

Rat C Reactive Protein (CRP) ELISA Kit
DL-CRP-Ra-48 1 kit of 48 tests
EUR 399.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat C Reactive Protein (CRP)

Rat C Reactive Protein (CRP) ELISA Kit
DL-CRP-Ra-96 1 kit of 96 tests
EUR 528.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat C Reactive Protein (CRP)

Rabbit C Reactive Protein (CRP) ELISA Kit
DL-CRP-Rb-192 1 kit of 192 tests
EUR 1130.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rabbit C Reactive Protein (CRP)

Rabbit C Reactive Protein (CRP) ELISA Kit
DL-CRP-Rb-48 1 kit of 48 tests
EUR 474.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rabbit C Reactive Protein (CRP)

Rabbit C Reactive Protein (CRP) ELISA Kit
DL-CRP-Rb-96 1 kit of 96 tests
EUR 635.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Rabbit C Reactive Protein (CRP)

Bovine C Reactive Protein (CRP) ELISA Kit
DLR-CRP-b-48T 48T
EUR 547.00
  • Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit
DLR-CRP-b-96T 96T
EUR 715.00
  • Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ch-48T 48T
EUR 508.00
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ch-96T 96T
EUR 661.00
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Hu-48T 48T
EUR 385.00
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Hu-96T 96T
EUR 492.00
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Mu-48T 48T
EUR 489.00
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Mu-96T 96T
EUR 635.00
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit
DLR-CRP-p-48T 48T
EUR 547.00
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit
DLR-CRP-p-96T 96T
EUR 715.00
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ra-48T 48T
EUR 426.00
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Ra-96T 96T
EUR 549.00
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Rb-48T 48T
EUR 508.00
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Rb-96T 96T
EUR 661.00
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit
RD-CRP-b-48Tests 48 Tests
EUR 555.00

Bovine C Reactive Protein (CRP) ELISA Kit
RD-CRP-b-96Tests 96 Tests
EUR 771.00

Chicken C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ch-48Tests 48 Tests
EUR 511.00

Chicken C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ch-96Tests 96 Tests
EUR 709.00

Human C Reactive Protein (CRP) ELISA Kit
RD-CRP-Hu-48Tests 48 Tests
EUR 372.00

Human C Reactive Protein (CRP) ELISA Kit
RD-CRP-Hu-96Tests 96 Tests
EUR 510.00

Mouse C Reactive Protein (CRP) ELISA Kit
RD-CRP-Mu-48Tests 48 Tests
EUR 489.00

Mouse C Reactive Protein (CRP) ELISA Kit
RD-CRP-Mu-96Tests 96 Tests
EUR 677.00

Porcine C Reactive Protein (CRP) ELISA Kit
RD-CRP-p-48Tests 48 Tests
EUR 555.00

Porcine C Reactive Protein (CRP) ELISA Kit
RD-CRP-p-96Tests 96 Tests
EUR 771.00

Rat C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ra-48Tests 48 Tests
EUR 419.00

Rat C Reactive Protein (CRP) ELISA Kit
RD-CRP-Ra-96Tests 96 Tests
EUR 577.00

Rabbit C Reactive Protein (CRP) ELISA Kit
RD-CRP-Rb-48Tests 48 Tests
EUR 511.00

Rabbit C Reactive Protein (CRP) ELISA Kit
RD-CRP-Rb-96Tests 96 Tests
EUR 709.00

Bovine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-b-48Tests 48 Tests
EUR 580.00

Bovine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-b-96Tests 96 Tests
EUR 807.00

Chicken C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ch-48Tests 48 Tests
EUR 534.00

Chicken C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ch-96Tests 96 Tests
EUR 742.00

Human C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Hu-48Tests 48 Tests
EUR 388.00

Human C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Hu-96Tests 96 Tests
EUR 533.00

Mouse C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Mu-48Tests 48 Tests
EUR 511.00

Mouse C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Mu-96Tests 96 Tests
EUR 709.00

Porcine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-p-48Tests 48 Tests
EUR 580.00

Porcine C Reactive Protein (CRP) ELISA Kit
RDR-CRP-p-96Tests 96 Tests
EUR 807.00

Rat C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ra-48Tests 48 Tests
EUR 437.00

Rat C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Ra-96Tests 96 Tests
EUR 603.00

Rabbit C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Rb-48Tests 48 Tests
EUR 534.00

Rabbit C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Rb-96Tests 96 Tests
EUR 742.00

Guinea pig C Reactive Protein (CRP) ELISA Kit
DL-CRP-Gu-192 1 kit of 192 tests
EUR 1180.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Guinea pig C Reactive Protein (CRP)

Guinea pig C Reactive Protein (CRP) ELISA Kit
DL-CRP-Gu-48 1 kit of 48 tests
EUR 492.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Guinea pig C Reactive Protein (CRP)

Guinea pig C Reactive Protein (CRP) ELISA Kit
DL-CRP-Gu-96 1 kit of 96 tests
EUR 660.00
Description: An ELISA kit based on the sandwich method for detection and quantification of Guinea pig C Reactive Protein (CRP)

Guinea pig C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Gu-48T 48T
EUR 527.00
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit
DLR-CRP-Gu-96T 96T
EUR 688.00
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit
RD-CRP-Gu-48Tests 48 Tests
EUR 533.00

Guinea pig C Reactive Protein (CRP) ELISA Kit
RD-CRP-Gu-96Tests 96 Tests
EUR 740.00

Guinea pig C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Gu-48Tests 48 Tests
EUR 557.00

Guinea pig C Reactive Protein (CRP) ELISA Kit
RDR-CRP-Gu-96Tests 96 Tests
EUR 774.00

TruStrip RDT Dog C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-D10 1 pack
EUR 171.00

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-H10 1 pack
EUR 171.00

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack
CRP-RDT-H25 1 pack
EUR 293.00

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-M10 1 pack
EUR 171.00

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack
CRP-RDT-M25 1 pack
EUR 293.00

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack
CRP-RDT-R10 1 pack
EUR 171.00

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack
CRP-RDT-R25 1 pack
EUR 293.00

CA199 (Cancer antigen) ELISA test
13 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)

CRP/ Rat CRP ELISA Kit
ELA-E0829r 96 Tests
EUR 886.00

Crp/ Rat Crp ELISA Kit
ELI-02799r 96 Tests
EUR 886.00

Canine CRP(CRP) ELISA Kit
QY-E70170 96T
EUR 426.00

CRP Antibody
1-CSB-PA790121
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

CRP Antibody
1-CSB-PA005116
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CRP. Recognizes CRP from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CRP antibody
10R-1042 100 ul
EUR 349.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-7893 1 mg
EUR 392.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-7894 1 mg
EUR 403.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C189A 1 mg
EUR 245.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C189B 1 mg
EUR 420.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33A 1 mg
EUR 238.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33AS 1 mg
EUR 235.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33B 1 mg
EUR 662.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-C33C 1 mg
EUR 245.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10C-CR2015M1 1 mg
EUR 168.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10C-CR2015M5 1 mg
EUR 165.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10C-CR2015M6 1 mg
EUR 165.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-10264 50 ug
EUR 241.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-3002 100 ug
EUR 265.00
Description: Mouse monoclonal CRP antibody

CRP antibody
70R-4527 50 ug
EUR 467.00
Description: Rabbit polyclonal CRP antibody raised against the N terminal of CRP

CRP Antiboday
70R-51961 100 ug
EUR 197.00
Description: Purified Rabbit CRP antibody

CRP protein
80R-4350 50 ug
EUR 349.00
Description: Purified Recombinant CRP protein (His tagged)

CRP Antibody
ABD6027 100 ug
EUR 438.00

CRP protein
30C-CP1000U 1 mg
EUR 349.00
Description: Purified native Human CRP protein

CRP protein
30R-2081 100 ug
EUR 322.00
Description: Recombinant human CRP protein

CRP protein
30R-2389 250 ug
EUR 152.00
Description: Purified recombinant Human CRP protein

CRP protein
30R-2740 10 ug
EUR 341.00
Description: Purified recombinant Human CRP protein

CRP protein
30R-2984 1 mg
EUR 380.00
Description: Purified recombinant Human CRP protein

CRP Protein
30R-3412 1 mg
EUR 300.00
Description: Human C-reactive protein

CRP protein
30R-AC001x 10 mg
EUR 457.00
Description: Highly purifed Human CRP protein

CRP protein
30R-AC067 1 mg
EUR 448.00
Description: Purified native Human CRP protein

CRP Antibody
31062-100ul 100ul
EUR 252.00

CRP Antibody
31062-50ul 50ul
EUR 187.00

CRP Antibody
32023-100ul 100ul
EUR 252.00

CRP protein
30-1092 1 mg
EUR 393.00
Description: Purified recombinant Human CRP protein

CRP protein
30-1094 100 ug
EUR 155.00
Description: Purified native Human CRP protein

CRP protein
30-1906 1 mg
EUR 336.00
Description: Native human CRP protein

CRP protein
30-AC05 5 mg
EUR 277.00
Description: Highly purified Human CRP protein

CRP protein
30-AC07 5 mg
EUR 1029.00
Description: Purified Recombinant CRP protein

CRP protein
30-AC10 5 mg
EUR 250.00
Description: Partially purified Human CRP protein

CRP antibody
10-1004 1 mg
EUR 457.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-2276 100 ug
EUR 221.00
Description: Recombinant Fab monoclonal CRP antibody

CRP antibody
10-2349 1 mg
EUR 349.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-2350 1 mg
EUR 349.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10-2703 1 mg
EUR 165.00
Description: Mouse Monoclonal CRP antibody

CRP antibody
10R-8426 100 ul
EUR 393.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-C189a 1 mg
EUR 284.00
Description: Mouse monoclonal CRP antibody

CRP antibody
10R-C189b 1 mg
EUR 399.00
Description: Mouse monoclonal CRP antibody

CRP antibody
20C-CR2015S 1 ml
EUR 133.00
Description: Sheep polyclonal CRP antibody

CRP antibody
20C-CR2015SP 1 ml
EUR 177.00
Description: Sheep polyclonal CRP antibody

CRP antibody
20-1002 1 ml
EUR 111.00
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-1003 1 ml
EUR 133.00
Description: Rabbit polyclonal Human CRP antibody

CRP antibody
20-1262 1 ml
EUR 647.00
Description: Sheep polyclonal CRP antibody

CRP antibody
20-B9007G000-W0 10 ml
EUR 116.00
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-B9007GD00-D0 5 mg
EUR 138.00
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3903GND1-D0 1 ml
EUR 133.00
Description: Polyclonal CRP antibody

CRP antibody
20-S3903GND9-D0 10 ml
EUR 127.00
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3911G000-S4 10 ml
EUR 116.00
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3911G000-V0 10 ml
EUR 133.00
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S3911G001-V0 10 ml
EUR 133.00
Description: Goat polyclonal Human CRP antibody

CRP antibody
20-S6011G000-S4 10 ml
EUR 138.00
Description: Goat polyclonal CRP antibody

CRP antibody
70-B9007GA00-A0 5 mg
EUR 241.00
Description: Goat polyclonal Human CRP antibody

CRP antibody
70R-10663 1 ml
EUR 484.00
Description: Rabbit polyclonal CRP antibody

CRP antibody
70R-13710 100 ug
EUR 322.00
Description: Affinity purified Sheep polyclonal CRP antibody

CRP Antibody
6690-100
EUR 338.00

CRP Antibody
6690-30T
EUR 146.00

CRP siRNA
20-abx901269
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRP Protein
abx069766-50ml 50 ml
EUR 1205.00
  • Shipped within 5-10 working days.

CRP siRNA
20-abx912842
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRP siRNA
20-abx912843
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CRP Antibody
1-CSB-PA06079A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CRP Antibody
1-CSB-PA181901
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CRP. Recognizes CRP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:100-1:300

crp Antibody
1-CSB-PA359785LA01ENV
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against crp. Recognizes crp from Escherichia coli. This antibody is Unconjugated. Tested in the following application: ELISA

CRP Antigen
E64C00501 1mg
EUR 700.00

CRP Antigen
E64C00502 1mg
EUR 700.00

anti-CRP
YF-PA27200 50 ug
EUR 363.00
Description: Mouse polyclonal to CRP

CRP Antibody
BF0116 200ul
EUR 376.00
Description: CRP antibody detects endogenous levels of total CRP.

CRP Antibody
DF6027 200ul
EUR 304.00
Description: CRP Antibody detects endogenous levels of total CRP.

hs-CRP/ Rat hs- CRP ELISA Kit
ELA-E0821r 96 Tests
EUR 886.00

CRP monoclonal antibody
10R-11480 1 mg
EUR 354.00
Description: Mouse anti-human C-reactive protein monoclonal antibody

CRP, human recombinant
4863-10
EUR 256.00

CRP, human recombinant
4863-1000
EUR 5270.00

CRP, human recombinant
4863-50
EUR 588.00

CRP, human recombinant
4864-1000
EUR 332.00

CRP, human recombinant
4864-250
EUR 147.00

CRP Polyclonal Antibody
41605-100ul 100ul
EUR 252.00

CRP Polyclonal Antibody
41605-50ul 50ul
EUR 187.00

CRP Polyclonal Antibody
A52500 100 µg
EUR 570.55
Description: reagents widely cited

crp Polyclonal Antibody
A55435 100 µg
EUR 570.55
Description: Ask the seller for details

CRP Polyclonal Antibody
ABP52927-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human CRP
  • Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

CRP Polyclonal Antibody
ABP52927-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human CRP
  • Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

CRP Polyclonal Antibody
ABP52927-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human CRP
  • Applications tips:
Description: A polyclonal antibody for detection of CRP from Human, Rat. This CRP antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CRP

Human CRP Antibody
abx023919-10ml 10 ml
EUR 356.00
  • Shipped within 5-10 working days.

Human CRP Protein
abx060113-1mg 1 mg
EUR 453.00
  • Shipped within 5-10 working days.

Human CRP Protein
abx060138-1mg 1 mg
EUR 453.00
  • Shipped within 5-10 working days.

Human CRP Protein
abx060712-1mg 1 mg
EUR 704.00
  • Shipped within 5-10 working days.

CRP cloning plasmid
CSB-CL005991HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 276
  • Sequence: atggagaagctgttgtgtttcttggtcttgaccagcctctctcatgcttttggccagacagacatgtcgaggaaggcttttgtgtttcccaaagagtcggatacttcctatgtatccctcaaagcaccgttaacgaagcctctcaaagccttcactgtgtgcctccacttctacac
  • Show more
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid
CSB-CL005991HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 141
  • Sequence: atgtgggactttgtgctgtcaccagatgagattaacaccatctatcttggcgggcccttcagtcctaatgtcctgaactggcgggcactgaagtatgaagtgcaaggcgaagtgttcaccaaaccccagctgtggccctga
Description: A cloning plasmid for the CRP gene.

CRP cloning plasmid
CSB-CL005991HU3-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 675
  • Sequence: ATGGAGAAGCTGTTGTGTTTCTTGGTCTTGACCAGCCTCTCTCATGCTTTTGGCCAGACAGACATGTCGAGGAAGGCTTTTGTGTTTCCCAAAGAGTCGGATACTTCCTATGTATCCCTCAAAGCACCGTTAACGAAGCCTCTCAAAGCCTTCACTGTGTGCCTCCACTTCTACAC
  • Show more
Description: A cloning plasmid for the CRP gene.

CRP Blocking Peptide
33R-5929 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRP antibody, catalog no. 70R-4527

CRP protein (Canine)
30-1093 100 ug
EUR 702.00
Description: Purified native Canine CRP protein

CRP calibrator set
35-S6021H000-L4 5 ml
EUR 133.00
Description: C-reactive Protein Calibrator Set

CRP ELISA kit
55R-IB59126 96 wells
EUR 378.00
Description: ELISA kit for the detection of CRP in the research laboratory

CRP ELISA kit
55R-IB79102 96 wells
EUR 579.00
Description: ELISA kit for the detection of CRP in the research laboratory

CRP antibody (FITC)
60R-2348 100 ug
EUR 327.00
Description: Rabbit polyclonal CRP antibody (FITC)

CRP Antibody, HRP
60R-2349 100 ug
EUR 332.00
Description: Rabbit polyclonal CRP antibody (HRP)

CRP Conjugated Antibody
C31062 100ul
EUR 397.00

They should therefore better be referred to as ‘subjunctivities’. The idiom of depression often becomes a rhetorical device to emphasize affiliation to a scientific medical discourse or citizenship and is often a statement to emphasize ‘scientific temper’ and modernity and to demarcate oneself from backwardness and superstition.